Library

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    Electronic Resource
    Electronic Resource
    Autoinducer-independent mutants of the LuxR transcriptional activator exhibit differential effects on the two lux promoters of Vibrio fischeri (1996)
    Springer
    Molecular genetics and genomics 252 (1996), S. 622-625 
    Details
    ISSN: 1617-4623
    Keywords: Key words Vibrio fischeri ; Luminescence ; LuxR ; Quorum sensing ; Autoinducer
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract  The LuxR protein is a transcriptional activator which, together with a diffusible small molecule termed the autoinducer [N-(3-oxohexanoyl)-L-homoserine lactone], represents the primary level of regulation of the bioluminescence genes in Vibrio fischeri. LuxR, in the presence of autoinducer, activates transcription of the luxICDABEG gene cluster and both positively and negatively autoregulates transcription of the divergently oriented luxR gene, activating transcription at low levels of autoinducer, and repressing synthesis at high autoinducer concentration. Seven LuxR point mutants which activate V. fischeri lux transcription in the absence of autoinducer (LuxR*) have been characterized. The LuxR* proteins activated transcription of the bioluminescence genes to levels 1.5–40 times that achieved by wild-type LuxR without autoinducer. All of the LuxR* mutants retained responsiveness to autoinducer. However, in each case the degree of stimulation in response to autoinducer was lower than that observed for wild-type LuxR. The LuxR* proteins retained the requirement for autoinducer for autoregulation of the luxR gene. We propose that the LuxR protein exists in two conformations, an inactive form, and an active form which predominates in the presence of autoinducer. The LuxR* mutations appear to shift the equilibrium distribution of these two forms so as to increase the amount of the active form in the absence of autoinducer, while autoinducer can still convert inactive to active species. The differential effects of the LuxR* proteins at the two lux promoters suggest that LuxR stimulates P luxR transcription by a different mechanism to that used at the P luxI promoter, implying that binding of LuxR to its binding site, known to be necessary for transcriptional activation, may not be sufficient.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02172408
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 2
    Electronic Resource
    Electronic Resource
    Autoinducer-independent mutants of the LuxR transcriptional activator exhibit differential effects on the twolux promoters ofVibrio fischeri (1996)
    Springer
    Molecular genetics and genomics 252 (1996), S. 622-625 
    Details
    ISSN: 1617-4623
    Keywords: Vibrio fischeri ; Luminescence ; LuxR ; Quorum sensing ; Autoinducer
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Abstract The LuxR protein is a transcriptional activator which, together with a diffusible small molecule termed the autoinducer [N-(3-oxohexanoyl)-l-homoserine lactone], represents the primary level of regulation of the bioluminescence genes inVibrio fischeri. LuxR, in the presence of autoinducer, activates transcription of theluxICDABEG gene cluster and both positively and negatively autoregulates transcription of the divergently orientedluxR gene, activating transcription at low levels of autoinducer, and repressing synthesis at high autoinducer concentration. Seven LuxR point mutants which activateV. fischeri lux transcription in the absence of autoinducer (LuxR*) have been characterized. The LuxR* proteins activated transcription of the bioluminescence genes to levels 1.5–40 times that achieved by wild-type LuxR without autoinducer. All of the LuxR* mutants retained responsiveness to autoinducer. However, in each case the degree of stimulation in response to autoinducer was lower than that observed for wild-type LuxR. The LuxR* proteins retained the requirement for autoinducer for autoregulation of theluxR gene. We propose that the LuxR protein exists in two conformations, an inactive form, and an active form which predominates in the presence of autoinducer. The LuxR* mutations appear to shift the equilibrium distribution of these two forms so as to increase the amount of the active form in the absence of autoinducer, while autoinducer can still convert inactive to active species. The differential effects of the LuxR* proteins at the twolux promoters suggest that LuxR stimulatesP luxR transcription by a different mechanism to that used at the P luxI promoter, implying that binding of LuxR to its binding site, known to be necessary for transcriptional activation, may not be sufficient.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/BF02172408
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 3
    Electronic Resource
    Electronic Resource
    The complete nucleotide sequence of the lux regulon of Vibrio fischeri and the luxABN region of Photobacterium leiognathi and the mechanism of control of bacterial bioluminescence (1989)
    New York : Wiley-Blackwell
    Journal of Bioluminescence and Chemiluminescence 4 (1989), S. 326-341 
    Details
    ISSN: 0884-3996
    Keywords: Nucleotide sequence ; genetic regulation ; bacterial luciferase ; amino acid sequence ; luxR ; autoinducer ; luxN ; Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Chemistry and Pharmacology
    Notes: We have determined the complete nucleotide sequence of a 7622 base pair fragment of DNA from Vibrio fischeri strain ATCC7744 that contains all the information required to confer plasmid-borne, regulated bioluminescence upon strains of Escherichia coli. The lux regulon from V. fischeri consists of two divergently transcribed operons, L (left) and R (right), and at least seven genes, luxR (L operon) and luxICDABE (R operon) and the intervening control region. The luxA and luxB genes encode respectively the α and β subunits of luciferase. The gene order luxCDABE seen in V. fischeri is the same as for V. harveyi. We have determined the sequence of the luxAB and flanking regions from Photobacterium leiognathi and have found upstream sequences homologous with luxC from the Vibrio species, but between luxB and luxE, there is an open reading frame encoding a protein of 227 amino acids (26,229 molecular weight) that is not found in this location in the Vibrio species. The amino terminal amino acid sequence of the encoded protein is nearly identical to that determined by O'Kane and Lee (University of Georgia) for the non-fluorescent flavoprotein from a closely related Photobacterium species (Dr Dennis O'Kane, personal communication). We have therefore designated this gene luxN.There is a 20-base inverted repeat ACCTGTAGGA×TCGTACAGGT, centred between bases 927 and 928 in the region between the two operons of V. fischeri. This region appears to fulfil two functions: it is critical for the LuxR protein to exert its effect and it is a consensus binding site for the E. coli LexA protein, a negative regulatory protein involved with the SOS response. There are sequences within the luxR coding region that appear to function in a cis-acting fashion to repress transcription from both the leftward and rightward promoters in the absence of the respective transcriptional activator proteins, thereby resulting in low basal levels of transcription. It now appears clear that there are multiple levels of control on the lux system allowing for a modulation of the intensity of bioluminescence of over four orders of magnitude.
    Additional Material: 11 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bio.1170040145
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 4
    Electronic Resource
    Electronic Resource
    Control of the lux regulon of Vibrio fischeri (1990)
    New York : Wiley-Blackwell
    Journal of Bioluminescence and Chemiluminescence 5 (1990), S. 99-106 
    Details
    ISSN: 0884-3996
    Keywords: Bioluminescence ; Vibrio fischeri ; positive feedback ; transcriptional regulation ; operator ; LexA ; LuxR ; Chemistry ; Biochemistry and Biotechnology
    Source: Wiley InterScience Backfile Collection 1832-2000
    Topics: Biology , Chemistry and Pharmacology
    Notes: Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxl, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP- dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxl gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of Luxl and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region. Hence there appear to be at least two effects resulting from the interaction between LuxR: autoinducer and the control region DNA. One effect is to relieve the repression afforded by the sequences within luxR and the second is to stimulate transcription from PR. Recent analysis of the rightward promotor by site-directed mutagenesis has suggested a different location for PR than that which was implicated in earlier studies. Our results suggest that the -35 sequence is located at a position which overlaps the 3′ edge of the LuxR binding site by one base pair.
    Additional Material: 7 Ill.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1002/bio.1170050205
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...