Library

X
feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    Electronic Resource
    Electronic Resource
    Cloning, sequencing and complementation analysis of the recA gene from Prevotella ruminicola (1996)
    Oxford, UK : Blackwell Publishing Ltd
    FEMS microbiology letters 144 (1996), S. 0 
    Details
    ISSN: 1574-6968
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Biology
    Notes: Abstract Degenerate PCR primers based on conserved RecA protein regions were used to amplify a portion of recE from Prevotella ruminicola strain 23, which was used as a probe to isolate the full-length recA gene from the P. ruminicola genomic library. The P. ruminicola recA gene encoded a protein of 340 amino acids with a molecular mass of 36.81 kDa. P. ruminicola RecA was highly similar to other RecA proteins and most closely resembled that of Bacteroides fragilis (75% identity). It alleviated the methyl methanesulfonate and mitomycin C sensitivities of Escherichia coli recA mutants, but did not restore the resistance to UV-light irradiation. Mitomycin C treatment of otherwise isogenic E. coli strains showed a higher level of prophage induction in a recA harboring lysogen.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1111/j.1574-6968.1996.tb08508.x
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 2
    Electronic Resource
    Electronic Resource
    Phylogenetic analysis of archaeal 16S rRNA libraries from the rumen suggests the existence of a novel group of archaea not associated with known methanogens (2001)
    Oxford, UK : Blackwell Publishing Ltd
    FEMS microbiology letters 200 (2001), S. 0 
    Details
    ISSN: 1574-6968
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Biology
    Notes: Molecular diversity of rumen archaea was analyzed by PCR amplification and sequencing of two 16S rRNA clone libraries prepared from the bovine rumen fluid using two different archaea-specific primer sets. The first library of 19 clones which was generated with primers D30 and D33, produced essentially two groups of sequences, one affiliated with Methanomicrobium mobile (21% of clones) and the other – with the uncultured archaeal sequences from anaerobic digester, which are distantly associated with Thermoplasma (79% of clones). The second library of 25 clones, which was generated with primers 0025e Forward and 1492 Reverse, produced a higher degree of diversity: in addition to the previous two groups, with the M. mobile- (56%) and Thermoplasma-associated sequences (20%), four clones (16%) were identified as Methanobrevibacter spp. The remaining two sequences were associated with unidentified archaeal sequences from the rumen and swine waste. Phylogenetic placement of eight almost complete 16S rRNA sequences revealed the existence of a novel cluster of the rumen Euryarchaeota, which is not affiliated with the known methanogenic archaea.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1111/j.1574-6968.2001.tb10694.x
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 3
    Electronic Resource
    Electronic Resource
    A small cryptic plasmid from Ruminobacter amylophilus NIAH-3 possesses functional mobilization properties (1999)
    Oxford, UK : Blackwell Publishing Ltd
    FEMS microbiology letters 181 (1999), S. 0 
    Details
    ISSN: 1574-6968
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Biology
    Notes: The complete nucleotide sequence of a small cryptic plasmid designated pRAO1, from the Gram-negative ruminal bacterium Ruminobacter amylophilus NIAH-3, was determined. The plasmid is a circular DNA molecule, 2140 bp in size, with a GC content of 40%. Computer-assisted analysis identified three open reading frames (ORFs), one of which, ORF3 (347 amino acids), displayed a high degree of amino acid identity with the Mob proteins involved in conjugative mobilization and interplasmid recombination of plasmids from Gram-positive bacteria. We proved the mobilization properties of pRAO1 in the Escherichia coli system using the coresident IncW broad-host-range conjugative plasmid R388. These data demonstrated, for the first time, the mobilization properties of small cryptic plasmids from Gram-negative inhabitants of the rumen.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1111/j.1574-6968.1999.tb08824.x
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 4
    Electronic Resource
    Electronic Resource
    Rumen bacterial diversity as determined by sequence analysis of 16S rDNA libraries (1999)
    Oxford, UK : Blackwell Publishing Ltd
    FEMS microbiology ecology 29 (1999), S. 0 
    Details
    ISSN: 1574-6941
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Biology
    Notes: Molecular diversity of rumen bacteria was analyzed by PCR amplification and sequencing of 16S rDNA clone libraries prepared from the rumen content of Holstein cows fasted for 16 h. A total of 84 clones, containing almost full size 16S rDNA sequences (about 1.5 kb long), were completely sequenced and subjected to an on line similarity search. Four sequences from the 84 clones closely resembled that of Butyrivibrio fibrisolvens and one clone was found to be related to Treponema bryantii. For 38% of the sequences, the similarity with database sequences was in the range of 90%–98% and for the remaining 56% the similarity was less than 90%. The bacterial community structure was also revealed by phylogenetic placement of sequences in relation to different fractions of rumen content. In the library from the rumen fluid, the sequences were affiliated with the following major phyla: low G+C Gram-positive bacteria (52.4%), Cytophaga-Flexibacter-Bacteroides (38.1%), Proteobacteria (4.7%) and Spirochaetes (2.4%). 2.4% had an uncertain affiliation. The vast majority of sequences from the rumen solids were found to be related to low G+C Gram-positive bacteria (71.4%) and the remaining sequences were placed within the Cytophaga-Flexibacter-Bacteroides (26.2%) and Spirochaetes (2.4%) phyla.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1111/j.1574-6941.1999.tb00607.x
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 5
    Electronic Resource
    Electronic Resource
    Construction of a Fibrobacter succinogenes Genomic Map and Demonstration of Diversity at the Genomic Level (1997)
    Springer
    Current microbiology 35 (1997), S. 22 -27 
    Details
    ISSN: 1432-0991
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Abstract. The genomic cleavage map of the type strain Fibrobacter succinogenes S85 was constructed. The restriction enzymes AscI, AvrII, FseI, NotI, and SfiI generated DNA fragments of suitable size distribution that could be resolved by pulsed-field gel electrophoresis (PFGE). An average genome size of 3.6 Mb was obtained by summing the total fragment sizes. The linkages between the 15 AscI fragments of the genome were determined by combining two approaches: isolation of linking clones and cross-hybridization of restriction fragments. The genome of F. succinogenes was found to be represented by the single circular DNA molecule. Southern hybridization with specific probes allowed the eight genetic markers to be located on the restriction map. The genome of this bacterium contains at least three rRNA operons. PFGE of the other three strains of F. succinogenes gave estimated genome sizes close to that of the type strain. However, RFLP patterns of these strains generated by AscI digestion are completely different. Pairwise comparison of the genomic fragment distribution between the type strain and the three isolates showed a similarity level in the region of 14.3% to 31.3%. No fragment common to all of these F. succinogenes strains could be detected by PFGE. A marked degree of genomic heterogeneity among members of this species makes genomic RFLP a highly discriminatory and useful molecular typing tool for population studies.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002849900205
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 6
    Electronic Resource
    Electronic Resource
    Sequence Analysis of Small Cryptic Plasmids Isolated from Selenomonas ruminantium S20 (1999)
    Springer
    Current microbiology 38 (1999), S. 107-112 
    Details
    ISSN: 1432-0991
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Abstract. Two small cryptic plasmids designated pONE429 and pONE430 were isolated from a rumen bacterium, Selenomonas ruminantium S20. The complete sequence of pONE429 was 2100 bp and contained one open reading frame (ORF) of 201 amino acids. The sequence of pONE430 had 1527 bp and one ORF of 171 amino acids with the similarity of replication protein (Rep protein) of pOM1, pSN2, and pIM13 isolated from Butyrivibrio fibrisolvens, Staphylococcus aureus, and Bacillus subtilis, respectively. In these plasmids, the upstream nucleotide sequence of Rep protein had the conserved nucleotides which could be double-strand origin (DSO) of rolling circle replication (RCR) mechanism. The plasmids of pONE429, pONE430, pJJMI, pJDB21, and pS23 were isolated from S. ruminantium strains and had similar regions that were located within a 〈450-bp nucleotide. These similar regions may be the location that was recognized by the host strain, S. ruminantium.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002849900412
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 7
    Electronic Resource
    Electronic Resource
    Characterization of the Cryptic Plasmid pSBO2 Isolated from Streptococcus bovis JB1 and Construction of a New Shuttle Vector (2000)
    Springer
    Current microbiology 41 (2000), S. 27-32 
    Details
    ISSN: 1432-0991
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Abstract A cryptic plasmid designated pSBO2 (3582 bp) was isolated from Streptococcus bovis JB1. The pSBO2 contained putative sites for a double-strand origin (dso), a small transcriptional repressor protein (Cop), countertranscribed RNAs (ctRNAs), and a replication protein (Rep), which were similar to those from pMV158 and pLS1, which were isolated from S. agalactiae, and pWVO1, isolated from Lactococcus lactis. The putative single-strand origin (sso) of pSBO2 was similar to pER341 and pST1, which were isolated from S. thermophilus. Recombinant plasmid designated pSBE2 was constructed to bind pECM184 vector and the DNA fragment containing sso, dso, Cop, ctRNAs, and Rep of pSBO2. When pSBE2 was introduced into S. bovis 12-U-1 and no8, the plasmids in the transformants had deleted the 160-bp fragment between sso and dso. This plasmid, designated pSBE2A, was capable of transforming Escherichia coli and S. bovis strains 12-U-1 and no8 on high frequency; therefore, pSBE2A is an effective shuttle vector.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002840010086
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 8
    Electronic Resource
    Electronic Resource
    Phenotypic Characterization of Polysaccharidases Produced by Four Prevotella Type Strains (2000)
    Springer
    Current microbiology 41 (2000), S. 45-49 
    Details
    ISSN: 1432-0991
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Abstract Four ruminal Prevotella type strains, P. ruminicola JCM8958T, P. bryantii B14T, P. albensis M384T, and P. brevis ATCC19188T, were characterized for polysaccharide-degrading activities with the reducing sugar release assay and zymogram analyses. Carboxymethylcellulase, xylanase, and polygalacturonate (PG)-degrading enzyme activities were determined in cultures grown on oat spelt xylan, xylose, arabinose, cellobiose, and glucose as sole growth substrates. P. ruminicola and P. albensis showed carboxymethylcellulase induction patterns. When xylan was supplied as a sole growth substrate, xylanase activities produced by P. bryantii and P. albensis were at least 18- and 11-fold higher, respectively, than during growth on other carbohydrates, suggesting that the regulation of the xylanases was highly specific to xylan. All strains constitutively produced PG-degrading enzymes. The corresponding activity of P. bryantii was more than 40-fold higher than in other strains. Zymogram analyses routinely detected the presence of high-molecular-weight (100–170 kDa) polysaccharide-degrading enzymes in ruminal Prevotella. Characteristics of the polysaccharide-degrading activities showed diversity of ruminal Prevotella species.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002840010089
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
  • 9
    Electronic Resource
    Electronic Resource
    Transcriptional Regulation of the Prevotella ruminicola recA Gene (1998)
    Springer
    Current microbiology 36 (1998), S. 259-265 
    Details
    ISSN: 1432-0991
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology , Medicine
    Notes: Abstract. The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region. At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions. Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative −10 and −35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (σ70) and B. subtilis (σA) consensus sequences, as well as to the recognition sites of other minor σ-factors. Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative −10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola. This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.
    Type of Medium: Electronic Resource
    URL: http://dx.doi.org/10.1007/s002849900306
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
    Paper (German National Licenses)
    Fulltext
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...