Analysis of the 3′ region of the sheep elastin gene

doi:10.1016/0003-9861(85)90595-8

Archives of Biochemistry and Biophysics

Volume 241, Issue 2, September 1985, Pages 684-691

https://doi.org/10.1016/0003-9861(85)90595-8 Get rights and content

Abstract

The nucleotide sequences of a 1279-bp sheep elastin cDNA clone, pcSEL1 [Yoon et al. (1984)Biochem. Biophys. Res. Commun.118, 261–269], and a 1230-bp sheep elastin genomic subclone, pSS1 [Davidson et al (1984)Biochem. J.220, 643–652], corresponding to a portion of the cDNA clone, were determined. These analyses permitted determination of the 100 amino acids at the carboxy terminus of sheep tropoelastin. A portion of this sequence showed strong homology to known sequences of pig tropoelastin, but most of the sequence had not been previously determined through protein sequencing. Novel aspects of the tropoelastin molecule which have been revealed by the present analyses are (i) the presence of an unusual sequence, KPPKP, which may contribute to crosslink formation; and (ii) the finding of cysteine within a sequence, CLGKSCGRKRK, at the putative carboxy terminus of tropoelastin. Because of the presence of these sequences, it is speculated that the carboxy-terminal region may be of importance in crosslinking tropoelastin molecules to themselves or to other matrix macromolecules. The nucleotide analyses revealed that sheep elastin mRNA contains a 974-bp untranslated sequence at the 3′ end, which appears to be strongly conserved among Species.

References (49)

E.J. Miller et al.
J. Biol. Chem
(1965)
R.B. Rucker et al.
Biochim. Biophys. Acta
(1973)
J.A. Foster et al.
J. Biol. Chem
(1973)
L. Murphy et al.
FEBS Lett
(1972)
J. Rosenbloom et al.
Biochem. Biophys. Res. Commun
(1976)
J. Uitto et al.
Arch. Biochem. Biophys
(1976)
D.W. Smith et al.
J. Biol. Chem
(1973)
J. Rosenbloom et al.
J. Biol. Chem
(1980)
W. Burnett et al.
Biochem. Biophys. Res. Commun
(1979)
J.M. Davidson et al.
J. Biol. Chem
(1982)

W. Burnett et al.

J. Biol. Chem

(1982)

K. Yoon et al.

Biochem. Biophys. Res. Commun

(1984)

J. Vieira et al.

Gene

(1982)

G. Heidecker et al.

Gene

(1980)

J.C. Myers et al.

J. Biol. Chem

(1983)

J.M. Davidson et al.

Methods Cell Biol

(1981)

J.M. Davidson et al.

J. Biol. Chem

(1985)

S.M. Partridge

Adv. Protein Chem

(1962)

C. Franzblau et al.

Biochem. Biophys. Res. Commun

(1965)

S.M. Partridge et al.

Nature (London)

(1966)

S.R. Pinnell et al.

L.B. Sandberg et al.

Biochemistry

(1969)

J.A. Foster et al.

Biochemistry

(1975)

A.S. Narayanan et al.

J. Biol. Chem

(1976)

Cited by (27)

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability
2000, Journal of Biological Chemistry
Citation Excerpt :
Whatever the mechanism, the specificity of the hybridization, despite the presence of protein, indicates that sufficient RNA nucleotide sequence must remain available to interact with the antisense probe. The G3A site does not resemble other known cis-acting 3′-UTR sequences affecting mRNA stability, including AU-rich elements of c-myc or c-fos mRNAs (21), iron-responsive elements of transferrin receptor mRNA (22), or the C-rich element of α-globin mRNA (23). Although the G3A sequence is well-conserved within elastin 3′-UTRs, few occurrences of this sequence in 3′-UTRs of other messages could be identified by data base searches.
Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3′-untranslated region (3′-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3′-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3′-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3′-UTR is an important element in the regulation of stability of the elastin mRNA.
Ascorbate differentially regulates elastin and collagen biosynthesis in vascular smooth muscle cells and skin fibroblasts by pretranslational mechanisms
1997, Journal of Biological Chemistry
Ascorbate contributes to several metabolic processes including efficient hydroxylation of hydroxyproline in elastin, collagen, and proteins with collagenous domains, yet hydroxyproline in elastin has no known function. Prolyl hydroxylation is essential for efficient collagen production; in contrast, ascorbate has been shown to decrease elastin accumulation in vitro and to alter morphology of elastic tissues in vivo. Ascorbate doses that maximally stimulated collagen production (10-200 μM) antagonized elastin biosynthesis in vascular smooth muscle cells and skin fibroblasts, depending on a combination of dose and exposure time. Diminished elastin production paralleled reduced elastin mRNA levels, while collagen I and III mRNAs levels increased. We compared the stability of mRNAs for elastin and collagen I with a constitutive gene after ascorbate supplementation or withdrawal. Ascorbate decreased elastin mRNA stability, while collagen I mRNA was stabilized to a much greater extent. Ascorbate withdrawal decreased collagen I mRNA stability markedly (4.9-fold), while elastin mRNA became more stable. Transcription of elastin was reduced 72% by ascorbate exposure. Differential effects of ascorbic acid on collagen I and elastin mRNA abundance result from the combined, marked stabilization of collagen mRNA, the lesser stability of elastin mRNA, and the significant repression of elastin gene transcription.
Extensive alternate exon usage at the 5′ end of the sheep tropoelastin gene
1995, Matrix Biology
Several overlapping cDNA clones were isolated from a λgt10 cDNA library constructed using polyA + RNA from neonatal sheep lung. DNA sequence analysis of these cDNA recombinants revealed the complete derived amino acid sequence of sheep tropoelastin. A comparison of DNA sequences from individual sheep tropoelastin cDNA also confirmed the presence of several tropoelastin mRNA isoforms in neonatal lung tissue.
Coding domains corresponding to exons 13, 14 and 33 were present in several of the sheep tropoelastin cDNA fragments but absent in others. The relative amount of alternate usage of these exons was quantitated by polymerase chain amplification. In confirmation of previous studies in other mammalian species, extensive alternate usage of exon 33 was observed in total RNA isolated from aorta, nuchal ligament and pulmonary artery from neonatal sheep. In striking contrast to all previous studies, however, exons 13 and 14 were shown to be subject to almost the same level of alternate usage as exon 33 in all three neonatal sheep tissues examined.
The elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis
1993, Cell
To identify genes involved in vascular disease, we investigated patients with supravalvular aortic stenosis (SVAS), an inherited vascular disorder that causes hemodynamically significant narrowing of large elastic arteries. Pulsed-field gel and Southern analyses showed that a translocation near the elastin gene cosegregated with SVAS in one family. DNA sequence analyses demonstrated that the translocation disrupted the elastin gene and localized the breakpoint to exon 28. Taken together with our previous study linking SVAS to the elastin gene in two additional families and existing knowledge of vascular biology, these data suggest that mutations in the elastin gene can cause SVAS.
The cysteine residues in the carboxy terminal domain of tropoelastin form an intrachain disulfide bond that stabilizes a loop structure and positively charged pocket
1992, Biochemical and Biophysical Research Communications
Analysis of purified bovine tropoelastin with Ellman's reagent and [¹⁴C]iodo-acetamide demonstrated that the only two cysteine residues in the molecule form an intrachain disulfide bond. Molecular modeling suggests that the cysteine residues are juxtaposed as the result of a tight turn that produces an antiparallel beta structure. Protruding from the C-terminal end of the turn is the sequence Arg-Lys-Arg-Lys which forms the floor of a positively charged pocket created by the extension of the arginine and lysine side chains on opposite sides of the peptide chain perpendicular to the plane of the turn. The side chain of a conserved lysine residue in the disulfide-bonded loop forms the top of the pocket. This positively charged pocket may define a binding site for acidic microfibrillar proteins that mediate elastic fiber assembly.
Cellular Expression of Tropoelastin mRNA Splice Variants
1992, Matrix
The primary transcript of tropoelastin is alternatively spliced into multiple mRNAs. The pattern and frequency of exon splicing is developmentally regulated, but the cellular profile of isoform expression within and among elastic tissues is not known. We used splice-variant specific antisense oligomeric deoxyribonucleotide probes in an in situ hybridization assay to assess the distribution of cells undergoing specific alternative splicing of tropoelastin pre-mRNA in developing bovine elastic tissues. Antisense oligomers were synthesized to exon sequences that are not alternatively spliced (exon 36) and to sequences that become abutted after high frequency (exon 33) and low frequency (exons 13 and 14) alternative splicing. The specificity of these probes for tropoelastin splice variants was verified by Southern hybridization to tropoelastin cDNAs with known exon deletions, and their specificity for tropoelastin mRNA was demonstrated by Northern hybridization. In situ hybridization with [³⁵S]-labeled oligomers on sections of bovine lobar pulmonary artery and other elastic tissues showed that all elastogenic cells produce multiple forms of tropoelastin mRNA. These observations suggest that the production of tropoelastin isoforms is common to all cells within an elastic tissue and that this multiplicity may not be involved in regional differences in elastic tissue architecture.

View all citing articles on Scopus

^☆: Supported by National Institutes of Health Research Grants AM-20552, DE-02623, and GM-32480; the Veterans Administration; and a gift from R. J. Reynolds Industries.

View full text

CommunicationAnalysis of the 3′ region of the sheep elastin gene☆

Abstract

J. Biol. Chem

Biochim. Biophys. Acta

J. Biol. Chem

FEBS Lett

Biochem. Biophys. Res. Commun

Arch. Biochem. Biophys

J. Biol. Chem

J. Biol. Chem

Biochem. Biophys. Res. Commun

J. Biol. Chem

J. Biol. Chem

Biochem. Biophys. Res. Commun

Gene

Gene

J. Biol. Chem

Methods Cell Biol

J. Biol. Chem

Adv. Protein Chem

Biochem. Biophys. Res. Commun

Nature (London)

Biochemistry

Biochemistry

J. Biol. Chem

Communication
Analysis of the 3′ region of the sheep elastin gene☆