Library

feed icon rss

Your email was sent successfully. Check your inbox.

An error occurred while sending the email. Please try again.

Proceed reservation?

Export
  • 1
    ISSN: 1432-1432
    Keywords: 5S RNA ; 5S RNA genes ; Nucleotide sequence ; Secondary structure ; Chloroplast evolution ; Endosymbiosis
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3′ end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 2
    Electronic Resource
    Electronic Resource
    Springer
    Journal of molecular evolution 35 (1992), S. 385-404 
    ISSN: 1432-1432
    Keywords: Endosymbiosis ; Molecular phylogeny ; Algal evolution ; Plastid origins
    Source: Springer Online Journal Archives 1860-2000
    Topics: Biology
    Notes: Summary An overview of recent molecular analyses regarding origins of plastids in algal lineages is presented. Since different phylogenetic analyses can yield contradictory views of algal plastid origins, we have examined the effect of two distance measurement methods and two distance matrix tree-building methods upon topologies for the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit nucleotide sequence data set. These results are contrasted to those from bootstrap parsimony analysis of nucleotide sequence data subsets. It is shown that the phylogenetic information contained within nucleotide sequences for the chloroplast-encoded gene for the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase, integral to photosynthesis, indicates an independent origin for this plastid gene in different plant taxa. This finding is contrasted to contrary results derived from 16S rRNA sequences. Possible explanations for discrepancies observed for these two different molecules are put forth. Other molecular sequence data which address questions of early plant evolution and the eubacterial origins of algal organelles are discussed.
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 3
    Electronic Resource
    Electronic Resource
    Amsterdam : Elsevier
    Archives of Biochemistry and Biophysics 280 (1990), S. 412-415 
    ISSN: 0003-9861
    Source: Elsevier Journal Backfiles on ScienceDirect 1907 - 2002
    Topics: Biology , Chemistry and Pharmacology , Physics
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 4
    Electronic Resource
    Electronic Resource
    Amsterdam : Elsevier
    Archives of Biochemistry and Biophysics 264 (1988), S. 343-347 
    ISSN: 0003-9861
    Source: Elsevier Journal Backfiles on ScienceDirect 1907 - 2002
    Topics: Biology , Chemistry and Pharmacology , Physics
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 5
    Electronic Resource
    Electronic Resource
    Amsterdam : Elsevier
    Archives of Biochemistry and Biophysics 100 (1963), S. 86-90 
    ISSN: 0003-9861
    Source: Elsevier Journal Backfiles on ScienceDirect 1907 - 2002
    Topics: Biology , Chemistry and Pharmacology , Physics
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 6
    Electronic Resource
    Electronic Resource
    Palo Alto, Calif. : Annual Reviews
    Annual Review of Plant Physiology 37 (1986), S. 467-506 
    ISSN: 0066-4294
    Source: Annual Reviews Electronic Back Volume Collection 1932-2001ff
    Topics: Biology
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 7
    Electronic Resource
    Electronic Resource
    Oxford, UK : Blackwell Publishing Ltd
    Real estate economics 27 (1999), S. 0 
    ISSN: 1540-6229
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Economics
    Notes: Existing studies of housing markets assume that homebuilding is a homogeneous, perfectly competitive industry. This paper uses MSA-level data on the average size of homebuilder establishments and homebuilder market concentration to test the appropriateness of this paradigm. The data reveal a wide and systematic variation across metropolitan-area housing markets in both the average size of builders and the market share for the largest builders in an MSA. These results are more consistent with treating homebuilders as monopolistically competitive suppliers of a differentiated product than with treating them as perfectly competitive homogeneous firms. Builders are larger in more active housing markets and where there is a greater supply of readily developed land suitable for large developments. Builder size and concentration are sensitive to the type of regulating jurisdiction imposing land-use regulation. Both are lower when land-use regulations are imposed by smaller jurisdictions, and this is particularly true when the smaller jurisdictions impose more intense regulation.
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 8
    Electronic Resource
    Electronic Resource
    Oxford, UK and Boston, USA : Blackwell Publishers Ltd
    Real estate economics 29 (2001), S. 0 
    ISSN: 1540-6229
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Economics
    Notes: Real estate development from raw land to completed structures is a multistage process. Given the current view of development as the exercise of a real option, the question arises whether development should be modeled as a compound option. This paper tests the validity of the compound option characterization by determining whether builders start units for which they have permits and then complete units started consistent with the predictions of the real options model. To do so, I first identify a reduced form relationship between permits and starts and then between starts and completions. The parameters of this relationship indicate how well permits proxy for starts and starts for completions. Then, I determine whether controlling for this structural relationship, new information, and uncertainty in returns affect permit exercise and completion rates, as in the exercise of real options. I find that current and previous quarter permits forecast current single-family starts, while multifamily starts require more quarterly lags of permits. More than one and two year’s worth of lagged starts numbers are needed to estimate current quarter completions for single- and multifamilys buildings, respectively. The principal result is that once building permits have been obtained, the development process proceeds to completion. While there is no evidence that completion is the exercise of an option embedded in a start, some aspects of permits are consistent with builders treating them as an option for starts. However, even if they do, given permits obtained, it takes large changes in market conditions to affect small changes in starts.
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 9
    ISSN: 1399-3038
    Source: Blackwell Publishing Journal Backfiles 1879-2005
    Topics: Medicine
    Notes: Recent studies from several laboratories suggest that the rate of postnatal maturation of T-cell function(s) associated with in vitro activation may be slower in children at high genetic risk for atopy (HR), compared to their normal (low risk; LR) counterparts. The present study compared the in vitro activity of the function-associated surface molecules CD2, CD3 and CD28 in panels of 27 HR and 13 LR infants, with a reference panel of 10 adults, employing assay systems involving T-cell stimulation with MoAbs against these molecules. The response maxima induced by saturating levels of the MoAbs were equivalent in all 3 groups, but T-cells from the HR infants required 10–50 fold higher levels of anti-CD3 stimulation to attain their maximum response, relative to adults (p = 0.02); T-cells from LR infants were also less responsive to anti-CD3 than adults, but these differences were smaller and did not attain statistical significance. It is suggested that these differences are attributable to varying proportions of competent T-memory cells (which respond to low levels of anti-CD3) in PBL from these populations, the postnatal accumulation of which proceeds slowest in the HR group.
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
  • 10
    Electronic Resource
    Electronic Resource
    Palo Alto, Calif. : Annual Reviews
    Annual Review of Plant Physiology and Plant Molecular Biology 42 (1991), S. 467-506 
    ISSN: 1040-2519
    Source: Annual Reviews Electronic Back Volume Collection 1932-2001ff
    Topics: Biology
    Type of Medium: Electronic Resource
    Library Location Call Number Volume/Issue/Year Availability
    BibTip Others were also interested in ...
Close ⊗
This website uses cookies and the analysis tool Matomo. More information can be found here...