ISSN:
1432-0886
Quelle:
Springer Online Journal Archives 1860-2000
Thema:
Biologie
,
Medizin
Notizen:
Abstract A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.
Materialart:
Digitale Medien
URL:
http://dx.doi.org/10.1007/BF00386794
Permalink
